View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12229_low_4 (Length: 235)
Name: NF12229_low_4
Description: NF12229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12229_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 41112247 - 41112457
Alignment:
| Q |
14 |
ataggacaatgtaatcgcatgctaaaaaattactgtacattttctagaagacctgaacgtccaattatgaaacttaaattaggagtatataccatcaata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41112247 |
ataggacaatgtaatcgcatgctaaaaaattactgtacattttctagaagacctaaacgtccaattatgaaacttaaattaggagtatataccatcaata |
41112346 |
T |
 |
| Q |
114 |
tcatggtggatgcttcacgcctgcatgttactagggattggcagcttagtttagaagttgaagttccaacctaaaagtgaagaatcttctttgacgtatc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41112347 |
tcatggtggatgcttcacgcctgcatgttactagggattggcagcttagtttagaagttgaagttccaacctaaaagtgaagaatcttctttgacgtatc |
41112446 |
T |
 |
| Q |
214 |
tgcaaatattg |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
41112447 |
tgcaaatattg |
41112457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University