View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12231_high_3 (Length: 304)
Name: NF12231_high_3
Description: NF12231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12231_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 29 - 303
Target Start/End: Complemental strand, 55174550 - 55174276
Alignment:
| Q |
29 |
agaaggttgatccaggcgaaggctcgtttattctgaccacctctctcatcatattgtttgagccgtgtatgtttgcgccaaacaaacatgactcccactc |
128 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55174550 |
agaaggttgatccaggtgaaggctcgtttattctgaccacctctctcatcatattgtttgagccgtgtatgtttgcgtcaaacaaacatgactcccactc |
55174451 |
T |
|
| Q |
129 |
acaatctcgccttcctttccatattattagttctcttaccagccattgccgcagcacatgatcatggtcgtgttgcaggcattaacaatgttacttatga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55174450 |
acaatctcgccttcctttccatattattagttctcttaccagccattgtcgcagcacatgatcatggtcgtgttgcaggcattaacaatgttacttatga |
55174351 |
T |
|
| Q |
229 |
tggtaaatcactctttgtcaatggaagacgcgagctcctcttctccggttccatccattacactcgcagcacccc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55174350 |
tggtaaatcactctttgtcaatggaagacgcgagctcctcttctccggttccatccattacactcgcagcacccc |
55174276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University