View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12235_high_14 (Length: 290)
Name: NF12235_high_14
Description: NF12235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12235_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 16 - 272
Target Start/End: Original strand, 5373895 - 5374153
Alignment:
| Q |
16 |
gctctaattaccgatgaattgttcagaagaattcgagttgaaactctgaatcgatnnnnnnnnnnnnnnnngaatcttcatcaatcatacacactcaaca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5373895 |
gctctaattaccgatgaattgttcagaagaattcgagttgatactctgaatcgataaaacaaaacaaaaaagaatcttcatcaatcatacacactcaaca |
5373994 |
T |
 |
| Q |
116 |
gttccaatccacaggttccaaatcaacaataaataccacacaacacatacattctcatatcccagaatcaaaaccnnnnnnngccatagactcataca-- |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
5373995 |
gttccaatccacaggttccaaatcaacaataaataccacacaacacatacattttcatatcccagaatcaaaaccaaaaaaagccatagattcatacact |
5374094 |
T |
 |
| Q |
214 |
gtctcaataaccatttcattcacagaactttggtgacaaccttaatgatgcagattctc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5374095 |
gtctcaataaccatttcattcacagaactttggtgacaaccttaatgatgcagattctc |
5374153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University