View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12235_low_20 (Length: 234)
Name: NF12235_low_20
Description: NF12235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12235_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 47 - 177
Target Start/End: Original strand, 19787606 - 19787736
Alignment:
| Q |
47 |
tggtacaagtcaattggtgcatttgttggcatattcgcaccaagatccttttcaaactgaaggtccaaatcacagaaggaatccacaggtttattatatt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19787606 |
tggtacaagtcaattggtgcatttgttggcatattcgcaccatggcccttttcagactgaaggtccaaatcacagaaggaatccacaagtttattatatt |
19787705 |
T |
|
| Q |
147 |
atgatatgggtgccatgttcaataaccatgt |
177 |
Q |
| |
|
||||| | ||||||||||||||| ||||||| |
|
|
| T |
19787706 |
atgatgtcggtgccatgttcaatgaccatgt |
19787736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 60 - 133
Target Start/End: Complemental strand, 19794511 - 19794438
Alignment:
| Q |
60 |
ttggtgcatttgttggcatattcgcaccaagatccttttcaaactgaaggtccaaatcacagaaggaatccaca |
133 |
Q |
| |
|
|||||||||||| ||| ||| | ||||||| ||||||||| ||| ||||||||||| || ||||||||||||| |
|
|
| T |
19794511 |
ttggtgcatttgctggtataagcacaccaaggtccttttcagacttaaggtccaaattactgaaggaatccaca |
19794438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University