View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12235_low_8 (Length: 467)
Name: NF12235_low_8
Description: NF12235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12235_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 17 - 466
Target Start/End: Original strand, 10681147 - 10681596
Alignment:
| Q |
17 |
cattgaaaggaatgactagtgttttacttgttggtgctgttggtcaagcaaggtatctcacacacatggcaagaacaagtttgttaccttcatggcttgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10681147 |
cattgaaaggaatgactagtgttttacttgttggtgctgttggtcaagcaagatatctcacacacatggcaagaacaagtttgttaccttcatggcttgc |
10681246 |
T |
 |
| Q |
117 |
aagagtgaatnnnnnnnctaagacaccagttaatgcaactgttgttatgtttattgcaactgctattgttgcatttttcactagccttgatattcttgct |
216 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10681247 |
aagagtgaataaaaaaactaagacaccagttaacgcaactgttgttatgtttattgcaactgctattgttgcatttttcactagccttgatattcttgct |
10681346 |
T |
 |
| Q |
217 |
aatttactttcaatttcaactttgttccttttttcacttgtggcattgtctctattggttaggagatattgtgttagaggtgtgacttctaggtttgatg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10681347 |
aatttactttcaatttcaactttgttccttttttcacttgtggcattgtctctattggttaggagatattgtgttagaggtgtgacttctaggtttgatg |
10681446 |
T |
 |
| Q |
317 |
ttatgaaatttcttggattcatttttctcatactaggatcatcgattggatgttcggtttattggtcgaaaaccgacgagtggataggttacatcatatt |
416 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
10681447 |
ttatgaaatttctcggattcatttttctcatactaggatcatcgattggatgttcggtttattggtcgaaaaccgacgagtggattggttacactatatt |
10681546 |
T |
 |
| Q |
417 |
agtacctatttggtttgtggggacattcggcatctggttctctgctcctc |
466 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
10681547 |
agtacctatttggtttgtggggacattcggcatctggttctttgttcctc |
10681596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University