View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12235_low_9 (Length: 461)
Name: NF12235_low_9
Description: NF12235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12235_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 14 - 444
Target Start/End: Original strand, 47308746 - 47309182
Alignment:
| Q |
14 |
gtgcttgataagtttgagggtaaaaatcggcgtaataatatataaacatgtatttcatacctgctaggagtaacccttttaaaattagtgtgttaagcta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47308746 |
gtgcttgataagtttgagggtaaaaatcggcgtaataatatataaacatgtatttcatacctgctaggagtaacccttttaaaattagtgtgttaagcta |
47308845 |
T |
|
| Q |
114 |
tgtgtgttagttgtttattagttatccnnnnnnnnnnnnnnnnnnnnngggaccttagggtatgtgtgttgttttattagtttctttcagttttcttgtt |
213 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47308846 |
tgtgtgttagttgtttattagttatcc----aaaaaaaaaaaaaaaaagggaccttagggtatgtgtgttgttttattagtttctttcagttttcttgtt |
47308941 |
T |
|
| Q |
214 |
gtgtgttactggcatggaatggttg--------ggaaggattttgcttttggaacagtttatggactagagaggacgatgctccgtagctgttttcattg |
305 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47308942 |
gtgtgttactggcatggaatggatggaatggatggaaggattttgcttttggaacagtttatggactagagaggacaatgctccgtagctgttttcattg |
47309041 |
T |
|
| Q |
306 |
caatggaagctcgggctggtctcacaagttctgatattccacatgtgtaannnnnnngtgattctactgttattgttgctcta---tattgtatgtccaa |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47309042 |
caatggaagctcgggctggtctcacaagttctgatattccacatgtgtaa-ttttttgtgattctactgttattgttgctctatattattgtatgtccaa |
47309140 |
T |
|
| Q |
403 |
taagagaataatgtggaggatggattaatttaggtggttcgt |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47309141 |
taagagaataatgtggaggatggattaatttaggtggttcgt |
47309182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University