View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12236_low_2 (Length: 327)
Name: NF12236_low_2
Description: NF12236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12236_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 16 - 309
Target Start/End: Complemental strand, 40629150 - 40628857
Alignment:
| Q |
16 |
tgtgtggttggaagaggtgaacgaagtttgtaattactcggaaaaagttgctggaaatttcattgcaagaagagaaaaatggttccaaatgagtagtcgt |
115 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||| || | ||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40629150 |
tgtgtggttggaacaggtgaacgaagtttgtgattacatggcagaagttgctgaagatttcattgcaagaagagaaaaatggttccaaatgagtagtcgt |
40629051 |
T |
 |
| Q |
116 |
cgtcttagtcttatgaggaaggtcctttatcacgatacttcctcatgggaatttaagaagcagatgaagcatgttagtattcaaattggagatgcacttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40629050 |
cgtcttagtcttatgaggaaggtcctttatcacgatacttcctcatgggaatttaagaagcagatgaagcatgttagtattcaaattggagatgcacttg |
40628951 |
T |
 |
| Q |
216 |
gcagaagtttgacttatgaagttgtgggagtgggagacatgaatgaaagaacaaaaagatcaacacccgttcaagacttgtcaatggagatttt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40628950 |
gcagaagtttgacttatgaagttgtgggagtgggagacatgaatgaaagaacaaaaagatcaacacccgttcaagacttgtcaatggagatttt |
40628857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 10 - 99
Target Start/End: Original strand, 40635976 - 40636065
Alignment:
| Q |
10 |
agaacctgtgtggttggaagaggtgaacgaagtttgtaattactcggaaaaagttgctggaaatttcattgcaagaagagaaaaatggtt |
99 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
40635976 |
agaaactgtgtggttggaagaggtgaacgaagtctgtaattactcggaaaaagttgctggaaatttcatttcaacaagagaaaaatggtt |
40636065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University