View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12236_low_3 (Length: 277)
Name: NF12236_low_3
Description: NF12236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12236_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 152 - 262
Target Start/End: Original strand, 1328904 - 1329014
Alignment:
| Q |
152 |
tcgttgtaagatccacaccagtgcgtgaaatgaagttagagcaaattttttccaaaatgcagcatttgcaattgcttcttgaacgctttttagcttgtcg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1328904 |
tcgttgtaagatccacaccagtgcgtgaaatgaagttagagcaaattttttccaaaatgcagcatttgcaattgcttcttgaacgctttttagcttgtcg |
1329003 |
T |
 |
| Q |
252 |
ccccacaggtt |
262 |
Q |
| |
|
||||||||||| |
|
|
| T |
1329004 |
ccccacaggtt |
1329014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 87
Target Start/End: Original strand, 1328752 - 1328821
Alignment:
| Q |
18 |
atatttggatgagaggcttgagtacaagatgcaaagtcggcgtggaaagcgtagcatgtttggttatgac |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1328752 |
atatttggatgagaggcttgagtacaagatgcaaagtcggcgtggaaagcgtagcatgtttggttatgac |
1328821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University