View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12238_low_7 (Length: 338)
Name: NF12238_low_7
Description: NF12238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12238_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 19 - 329
Target Start/End: Complemental strand, 7667178 - 7666868
Alignment:
| Q |
19 |
catccatcattcttcatcttgatcttcaatatcatcataaatttttctatgatatattccttgtcagaaacagaagctttattaaatctaaaaaactcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7667178 |
catccatcattcttcatcttgatcttcaatatcatcataaatttttctatgatatattccttgtcagaaacagaagctttattaaatctaaaaaactcat |
7667079 |
T |
 |
| Q |
119 |
tctcaaatgctaatgctctaaatagttggtttgccaacactttaccttgtaccgaagacgatcaatgggaaggcgttgtttgttacaacggtcttgtaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7667078 |
tctcaaatgctaatgctctaaatagttggtttgccaacactttaccttgtaccgaagacgatcaatgggaaggcgttgtttgttacaacggtcttgtaac |
7666979 |
T |
 |
| Q |
219 |
cggtctgcgccttgaaggaatgggattattcggcaaaattgatgttgatgcattgcttgaacttaagggtttaagaactattagtcttatgaacaattct |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
7666978 |
cggtctgcgccttgaaggaatgggattattcggcaaaattgatgttgatgcattgcttgaacttaagggtttaagaactattagtttcatgaacaattct |
7666879 |
T |
 |
| Q |
319 |
ttcacaggttc |
329 |
Q |
| |
|
||||| ||||| |
|
|
| T |
7666878 |
ttcactggttc |
7666868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University