View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12239_high_16 (Length: 299)
Name: NF12239_high_16
Description: NF12239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12239_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 36160744 - 36160930
Alignment:
| Q |
1 |
tgaagtataagtagtaaaataaagcactcaagtaactagtc-atagccattatcataatatttagtcaaaatagtaaaaaggaataggggcatgatccac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36160744 |
tgaagtataagtagtaaaataaagcactcaagtaactagtccatagccattatcacaatatttagtcaaaatagtaaaaaggaataggggcatgatccac |
36160843 |
T |
 |
| Q |
100 |
attactacacttggtgttctactcatagagtcactatttctccactttcatagtggttggacatcatgattgcttcacgcttatgcc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36160844 |
attactacacttggtgttctactcatagagtcactatttctccactttcatagtggttggacatcatgattgcttcacgcttatgcc |
36160930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 242 - 281
Target Start/End: Original strand, 36160986 - 36161025
Alignment:
| Q |
242 |
ttatgatgttttgtatgtttcctttgaaaatatataggta |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36160986 |
ttatgatgttttgtatgtttcctttgaaaatatataggta |
36161025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University