View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12239_high_26 (Length: 237)
Name: NF12239_high_26
Description: NF12239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12239_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 2 - 53
Target Start/End: Original strand, 13875226 - 13875277
Alignment:
| Q |
2 |
tttttaatgcctaatatcttagatatgatttcaaccattagatgcatgacta |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13875226 |
tttttaatgcctaatatcttagatatgatttcaaccattagatgcaggacta |
13875277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 13875403 - 13875453
Alignment:
| Q |
173 |
ttagaagggttaatctatcatgctcctcttccccttcttcatcttcattct |
223 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13875403 |
ttagaagggttaatctatcatgctcgtcttccccttcttcatcttcattct |
13875453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 46496820 - 46496778
Alignment:
| Q |
2 |
tttttaatgcctaatatcttagatatgatttcaaccattagat |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46496820 |
tttttaatgcctaatatcttagatatgatttcaaccattagat |
46496778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 31281092 - 31281134
Alignment:
| Q |
2 |
tttttaatgcctaatatcttagatatgatttcaaccattagat |
44 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
31281092 |
tttttaatgtctaatatcttaaatatgatttcagccattagat |
31281134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 55425598 - 55425556
Alignment:
| Q |
2 |
tttttaatgcctaatatcttagatatgatttcaaccattagat |
44 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
55425598 |
tttttaatgtctaatatcttaaatatgatttcagccattagat |
55425556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 28655693 - 28655735
Alignment:
| Q |
2 |
tttttaatgcctaatatcttagatatgatttcaaccattagat |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28655693 |
tttttaatgcctaatatcttagatatgatttcagccattagat |
28655735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 11242855 - 11242897
Alignment:
| Q |
2 |
tttttaatgcctaatatcttagatatgatttcaaccattagat |
44 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
11242855 |
tttttaatgtctaatatctcagatatgatttcagccattagat |
11242897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University