View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12239_high_5 (Length: 469)
Name: NF12239_high_5
Description: NF12239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12239_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 299 - 353
Target Start/End: Complemental strand, 3438871 - 3438817
Alignment:
| Q |
299 |
gcaagagttttgcttgccagctttctaattttgtgtttaacctatcaaacaagta |
353 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||| | |||||||||| |
|
|
| T |
3438871 |
gcaagagctttgcttgccagctttctaattttgtgttttacccaacaaacaagta |
3438817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University