View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12239_low_20 (Length: 288)
Name: NF12239_low_20
Description: NF12239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12239_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 271
Target Start/End: Original strand, 47374752 - 47375022
Alignment:
| Q |
10 |
gcagagattcaataaaaacaccatcttcaatactttatatttttaattcacaagcaaaca---------ggtcgagtatttggtcttctcaagtcatgct |
100 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47374752 |
gcagagattcaataaaaatatcatcttcaatactttatatttttaattcacaagcaaacaccaaagataggtcgagtatttggtcttctcaagtcatgct |
47374851 |
T |
|
| Q |
101 |
ctcaaagatatggattgatatgaattagaacatcatgtatcaacgttaatttctctatcatgacaaacgtcttggataaatgcttcttctcgagaaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
47374852 |
ctcaaagatatggattgatatgaattagaacatcatgtatcaacgttaatttctctatcatgacaaacgtcttggataaaagcttcttctcgaaaaattt |
47374951 |
T |
|
| Q |
201 |
cctcaacagtgaacaataccgattcaaagaaaacaactcaacgttcgaaggcaccctcgtagacttgaatt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47374952 |
cctcaacagtgaacaataccgattcaaagaaaacaactcaacgttcgaaggcaccctcgtagacttgaatt |
47375022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University