View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12239_low_21 (Length: 270)
Name: NF12239_low_21
Description: NF12239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12239_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 10 - 253
Target Start/End: Complemental strand, 46800426 - 46800184
Alignment:
| Q |
10 |
agaacctgtgggttagagaaatgaaaatcccataaaataagggaagccaaatcaaacgtagggcaccacatacaaccatcaacgagaactaacacacatc |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||||| |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46800426 |
agaacatgtgggttagagaaatgaaaatcccgtaaaataagggaagtcaaatcaaacgtggggcgccacatacaaccatcaacgggaactaacacacatc |
46800327 |
T |
|
| Q |
110 |
catccacccatgagaataattgaatatgcctgtcagggttagattttgtaggccacaatgttttggatatattgtgcatctcattttagacatacacaat |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46800326 |
catccacccatgagaataactgaatatgca-gtcagtgttagattttgtaggccacaatgttttggatatattgtgcatctcattttagacatacacaat |
46800228 |
T |
|
| Q |
210 |
taatcaaagtaatcatttttcttgtaatttacctcatctttttg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46800227 |
taatcaaagtaatcatttttcttgtaatttaccttatctttttg |
46800184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University