View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12239_low_23 (Length: 265)
Name: NF12239_low_23
Description: NF12239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12239_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 8293786 - 8293547
Alignment:
| Q |
18 |
aaacaatactaacctaactattaacatactaatattctacatttgttattnnnnnnntagcacctaaaccagagatgcaattaattatatggagatcaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8293786 |
aaacaatactaacctaactattaacatactaatattctacatttgttattaaaaaaatagcacctaaaccagagatgcaattaattatatggagatcaaa |
8293687 |
T |
|
| Q |
118 |
tgcacatgacacggacgctatacaaaacgcagcaacaaaatatctggaatcagagaaattaacacggaagagaagaga-aaaataaatggacacataaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8293686 |
tgcacatgacacggacgctatacaaaacgcagcaacaaaatatctggaatcagagaaattaacacggaagagaagagaaaaaataaatggacacataaga |
8293587 |
T |
|
| Q |
217 |
tttaccagtttcaatcaattgtaagcagctccacaggttc |
256 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8293586 |
tttaccagtttcagtcaattgtaagcagctccacaggttc |
8293547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University