View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12239_low_25 (Length: 251)
Name: NF12239_low_25
Description: NF12239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12239_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 232
Target Start/End: Original strand, 43842707 - 43842931
Alignment:
| Q |
8 |
aggagcagagacaatcactaaaatttagcaaaatcaagcacaagagattaattgtgaaacacatggaagaaactacggagagattatcaactaagaaaga |
107 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43842707 |
aggaacagaaacaatcactaaaatttagcaaaatcaagcacaagagattaattgtgaaacacatggaagaaactacggagagattatcaactaagaaaga |
43842806 |
T |
|
| Q |
108 |
agagaaaacaatggctttctatgtttaccatccatgctattgtcttgaagaaattttcaagacttttttgaggtgttttggtattgagtccacccaaacc |
207 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43842807 |
agagaaaacaatgactttctatgtttaccatccatgctattgtcttgaagaaattttcaagacttttttgaggtgttttggtattgagtccacgcaaacc |
43842906 |
T |
|
| Q |
208 |
aaagaagaagaagattcatcaacat |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43842907 |
aaagaagaagaagattcatcaacat |
43842931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University