View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12240_high_3 (Length: 218)
Name: NF12240_high_3
Description: NF12240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12240_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 9468093 - 9467906
Alignment:
| Q |
18 |
cacacataccatatatttggttaaccgaaagttgtgttgcaatgtcaacctatttttattcatttttaaatgcatagaggtaattgcgtttctattatct |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9468093 |
cacacataccatatatttggttaactgaaagttgtgttgcagtgtcaacctatttttattcatttttaaatgcatagaggtaattgcgtttctattatct |
9467994 |
T |
 |
| Q |
118 |
tcggagggctggctatgccatatatgaaattataacaagtttgatgtgtgattctcttgaacatgtcactcacaatactatctctgct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9467993 |
tcggagggctggctatgccatatatgaaattataacaagtttgatgtgtgattctcttgaacatgtcactcacaatactatcactgct |
9467906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 131 - 194
Target Start/End: Original strand, 8925810 - 8925873
Alignment:
| Q |
131 |
tatgccatatatgaaattataacaagtttgatgtgtgattctcttg-aacatgtcactcacaata |
194 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| || || |||||||||||||||||| |
|
|
| T |
8925810 |
tatgccatatatgaaattat-acaagtttgaattgtgattttcctgcaacatgtcactcacaata |
8925873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University