View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12240_low_5 (Length: 265)
Name: NF12240_low_5
Description: NF12240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12240_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 65 - 255
Target Start/End: Original strand, 963146 - 963335
Alignment:
| Q |
65 |
agtagtttcacagtttgatatatggactgatcaaggtaatatttgttccaaacaggttgcagaatatggagaagaaggagaagttgttggagtgataagg |
164 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
963146 |
agtagtttcacagtttgatat-tggactaatcaatgtaatatttgttccaaacaggttgcagaatatgaagaagaaggagaagttgctggagtgataagg |
963244 |
T |
|
| Q |
165 |
ggttgtgtgaaaacagttacaagagggaattcagcttatgtaaaactagcttatgttttaggacttagagtctctcccaaacacaggttct |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
963245 |
ggttgtgtgaaaacagttacaagagggaattcagcttatgtaaaactagcttatgttttaggacttagagtctctcccaaacacaggttct |
963335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 963020 - 963056
Alignment:
| Q |
20 |
gtatacctaatgcgacattatgttttagtgctgaata |
56 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
963020 |
gtatatctaatgcgacattatgttttagtgttgaata |
963056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University