View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12241_high_13 (Length: 314)
Name: NF12241_high_13
Description: NF12241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12241_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 10522009 - 10522280
Alignment:
| Q |
1 |
tttgattaagtaaaatattatccaaacaacaatttcttggcatcacctatgggtcataacctaagttatgtgtggagcagtatttttaacgggaaaatta |
100 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||| |
|
|
| T |
10522009 |
tttgtttaagtcaaatattatccaaacaacaatttcttggcatcacctatgggtcataacctaagttatgtgtggagcagtagttttaacggaaaattta |
10522108 |
T |
 |
| Q |
101 |
ttgtgtgtgcatgatctcgatggtgcatcgggtcaggtgcaaacatcgccatattggaggaaccatggcttgttgacggtggtcgcatatcttgtgccaa |
200 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10522109 |
ttgtatgtgcaggatctcgatggtgcatcgggtcaggtgcaaacatcgccatattggaggaaccatggcttgttgacggtggtcgcatatcttgtgccaa |
10522208 |
T |
 |
| Q |
201 |
tcaaggtagttttcactttagaaatacaacggttgataatttgattgataacacaaataaggcttggagtca |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10522209 |
tcaaggtagttttcactttagaaatacaacggttgataacttgattgataacacaaataaggcttggagtca |
10522280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University