View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12241_high_17 (Length: 278)
Name: NF12241_high_17
Description: NF12241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12241_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 9 - 167
Target Start/End: Original strand, 33658333 - 33658491
Alignment:
| Q |
9 |
agcagagaataatcacacacttgttgctttcagtgtgacatttgtcagtgccaaccactctaataataagtatacaaatagatagtctcatatcaaattt |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33658333 |
agcaaagaataatcacacacttgttgctttcagtgtgacatttgtcagtgccaaccactctaataataagtatacaaatagatagtctcatgtcaaattt |
33658432 |
T |
 |
| Q |
109 |
cttcaaacaagttatacttcaaaaatttgtgtatcttatttgagattcttgttagatct |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33658433 |
cttcaaacaagttatacttcaaaaatttgtgtatcttatttgagattcttgttagatct |
33658491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University