View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12241_high_20 (Length: 252)
Name: NF12241_high_20
Description: NF12241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12241_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 25 - 239
Target Start/End: Complemental strand, 13422401 - 13422183
Alignment:
| Q |
25 |
tatccgtcaaaatttat----gaatccgtccctgcaaccagtaatatgaatgaaaatggagattctttctctagtgagcttaatcatgttttgggctcta |
120 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13422401 |
tatccgtcaaaatttatatatggatccgtccctgcaaccagtaatatgaatgaaaatggagattctttctctagtgagcttaatcatgttttgggctcta |
13422302 |
T |
 |
| Q |
121 |
tcaaatggatacatgtcttcatataaaccaaccatgtagttgatgcttcgcacactcttttgagtgattctgtgtgagttatatttttcctaggtcttcc |
220 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
13422301 |
tcaaatggatacatgtcttcagataaaccaaccatgtagttgatgcttcgcacactcttttgagtgattctgtgggagttatattttttctaggtcttcc |
13422202 |
T |
 |
| Q |
221 |
tagtatatgttttgagcct |
239 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13422201 |
tagtatatgttttgagcct |
13422183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University