View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12241_high_22 (Length: 232)
Name: NF12241_high_22
Description: NF12241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12241_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 2103865 - 2103665
Alignment:
| Q |
18 |
attcttactagaggattttcaaggaaatattgcaaatgtgggagtttaaaatggtggacatcatcgttttcttatccgtccatggatttacgcacacaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2103865 |
attcttactagaggattttcaaggaaatattgcaaatgtgggagtttaaaatggtggacatcatcgttttcttatccgtccatggatttacgcacacaaa |
2103766 |
T |
 |
| Q |
118 |
aaggagaatgtccgtcactgttggacttgtgcgtccagaaaataagtgaggtattgtttatcaatcgataagtttcctttgtccag-ctcatattttcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2103765 |
aaggagaatgtccgtcactgttggacttgtgcgtccagaaaataagtgaggtattgtttaacaatcgataagtttcctttgtccagactcatattttcat |
2103666 |
T |
 |
| Q |
217 |
c |
217 |
Q |
| |
|
| |
|
|
| T |
2103665 |
c |
2103665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University