View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12241_high_24 (Length: 225)
Name: NF12241_high_24
Description: NF12241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12241_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 31266951 - 31267129
Alignment:
| Q |
17 |
agacagaaccatcaaccatcagtggtacgcataatccaaagaatccaaggtgccaaaaatttccttcatcgcagaagcatgaagagggtgcgttgagatc |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31266951 |
agacagaaccgtcaaccatcagtggtacgcataatccaaagaatccg-ggtgccaaaaatttccttcatcgcagaagcatgaagagggtgtgttgagatc |
31267049 |
T |
|
| Q |
117 |
tttaaaaacttcagt---gcatactctcattaatataattaatagaagtaaatcctttagtacgagtaaaattaagtact |
193 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31267050 |
tttaaaaacttcagtacagcatactctcattaatataattaatagaagtaaatcctttagtacgagtaaaactaagtact |
31267129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University