View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12241_low_13 (Length: 337)
Name: NF12241_low_13
Description: NF12241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12241_low_13 |
 |  |
|
| [»] scaffold0273 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 6 - 319
Target Start/End: Complemental strand, 22706908 - 22706594
Alignment:
| Q |
6 |
cagaacctgtgatgatgtcagcttctggtaaacttgcttgtgatgacatgcttctgatgacgtcaacttctgatgtattttagaaccacttgtcaaatat |
105 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
22706908 |
cagaacttctgatgatgtcagcttctggtaaacttgcttgtgatgacatgcttctgatgacgtcaacttttgatgtactttagaaccacttgtcaaatat |
22706809 |
T |
 |
| Q |
106 |
tacaatattacaatttaattttggatattcaaaaaatcatccaaataaaaccatatttaattggactagatcgaatctcatgtgaa-nnnnnnnggacca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22706808 |
tacaatattacaatttaattttggatattcaaaaaatcatccaaataaaaccatatttaattggactagatcgaatctcatgtgaattttttttggacca |
22706709 |
T |
 |
| Q |
205 |
gatacctcaaaacatatccaaattgcactgtaaacactcgttattcacatatgattacaccgacacgtattttgtatgaatgttatacagatgaacaact |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
22706708 |
gatacctcaaaacatatccaaattgcactgtaaacactcgttattcacatatgattacaccgttacatattttgtatgaatgttatacagatgaacaact |
22706609 |
T |
 |
| Q |
305 |
aaaatgaatgcacat |
319 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
22706608 |
aaaatgaatgcacat |
22706594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 71
Target Start/End: Original strand, 21618466 - 21618515
Alignment:
| Q |
23 |
tcagcttctggtaaacttgcttgtgatg-acatgcttctgatgacgtcaa |
71 |
Q |
| |
|
|||||||||| ||||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
21618466 |
tcagcttctgataaacttgcttctgatgaacttgcttctgatgacgtcaa |
21618515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 6 - 99
Target Start/End: Complemental strand, 18896470 - 18896377
Alignment:
| Q |
6 |
cagaacctgtgatgatgtcagcttctggtaaacttgcttgtgatgacatgcttctgatgacgtcaacttctgatgtattttagaaccacttgtc |
99 |
Q |
| |
|
|||||| | ||||||||||||| |||||| |||| |||| |||||| ||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
18896470 |
cagaacttctgatgatgtcagcctctggtgaactagcttctgatgaggtgcttctgatgacgtcagcttctgatgtacttcagaaccacttgtc |
18896377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 54 - 99
Target Start/End: Original strand, 18615150 - 18615195
Alignment:
| Q |
54 |
tgcttctgatgacgtcaacttctgatgtattttagaaccacttgtc |
99 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||| |||||| |
|
|
| T |
18615150 |
tgcttctgatgacgtcaacttctgatgattttcagaacctcttgtc |
18615195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 19115338 - 19115410
Alignment:
| Q |
26 |
gcttctggtaaacttgcttgtgatgacatgcttctgatgacgtcaacttctgatgtattttagaaccacttgt |
98 |
Q |
| |
|
||||||||| | ||||||| |||||| ||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
19115338 |
gcttctggtgaccttgcttctgatgaggtgcttctgatgacgtcaacttctgatgtactccagaaccacttgt |
19115410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 23 - 70
Target Start/End: Complemental strand, 23184212 - 23184165
Alignment:
| Q |
23 |
tcagcttctggtaaacttgcttgtgatgacatgcttctgatgacgtca |
70 |
Q |
| |
|
|||||||||||| ||||||||| |||||| ||||||||||||||||| |
|
|
| T |
23184212 |
tcagcttctggtgaacttgcttctgatgaggtgcttctgatgacgtca |
23184165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 23 - 70
Target Start/End: Complemental strand, 23595469 - 23595422
Alignment:
| Q |
23 |
tcagcttctggtaaacttgcttgtgatgacatgcttctgatgacgtca |
70 |
Q |
| |
|
|||||||||||| ||||||||| |||||| ||||||||||||||||| |
|
|
| T |
23595469 |
tcagcttctggtgaacttgcttctgatgaggtgcttctgatgacgtca |
23595422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 6 - 51
Target Start/End: Complemental strand, 26619000 - 26618955
Alignment:
| Q |
6 |
cagaacctgtgatgatgtcagcttctggtaaacttgcttgtgatga |
51 |
Q |
| |
|
|||||| | |||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
26619000 |
cagaacttctgatgatgtcagcttctggtgaacttgcttctgatga |
26618955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 54 - 98
Target Start/End: Complemental strand, 26618966 - 26618922
Alignment:
| Q |
54 |
tgcttctgatgacgtcaacttctgatgtattttagaaccacttgt |
98 |
Q |
| |
|
|||||||||||| |||| ||||||||||| || |||||||||||| |
|
|
| T |
26618966 |
tgcttctgatgatgtcagcttctgatgtacttcagaaccacttgt |
26618922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 33074442 - 33074490
Alignment:
| Q |
23 |
tcagcttctggtaaacttgcttgtgatg-acatgcttctgatgacgtca |
70 |
Q |
| |
|
|||||||||| ||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
33074442 |
tcagcttctgataaacttgcttctgatgaacttgcttctgatgacgtca |
33074490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 24 - 99
Target Start/End: Original strand, 17540629 - 17540704
Alignment:
| Q |
24 |
cagcttctggtaaacttgcttgtgatgacatgcttctgatgacgtcaacttctgatgtattttagaaccacttgtc |
99 |
Q |
| |
|
||||||||||| | ||||||| |||||| ||||||||||||||||| ||||||||||| | | ||||||||||| |
|
|
| T |
17540629 |
cagcttctggtgatcttgcttctgatgaggtgcttctgatgacgtcagcttctgatgtactccacaaccacttgtc |
17540704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 17787956 - 17787894
Alignment:
| Q |
15 |
tgatgatgtcagcttctggtaaacttgcttgtgatgaca-tgcttctgatgacgtcaacttct |
76 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||| | ||||||||||||||||| ||||| |
|
|
| T |
17787956 |
tgatgatgtcagcttctggtgaactagcttctgatgagagtgcttctgatgacgtcagcttct |
17787894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 277
Target Start/End: Complemental strand, 15155665 - 15155591
Alignment:
| Q |
203 |
cagatacctcaaaacatatccaaattgcactgtaaacactcgttattcacatatgattacaccgacacgtatttt |
277 |
Q |
| |
|
||||||||| |||||| || |||| ||||| |||||| | |||||||||||||||||||| ||||| |||||| |
|
|
| T |
15155665 |
cagataccttaaaacaaattcaaactgcaccccaaacaccctttattcacatatgattacactgacacatatttt |
15155591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0273 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0273
Description:
Target: scaffold0273; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 15 - 69
Target Start/End: Original strand, 5859 - 5913
Alignment:
| Q |
15 |
tgatgatgtcagcttctggtaaacttgcttgtgatgacatgcttctgatgacgtc |
69 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||| ||||| |||||||||| |
|
|
| T |
5859 |
tgatgatgtcagcttctggtgaacttgcttctgatgaggtgcttttgatgacgtc |
5913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 38 - 99
Target Start/End: Complemental strand, 22461558 - 22461497
Alignment:
| Q |
38 |
cttgcttgtgatgacatgcttctgatgacgtcaacttctgatgtattttagaaccacttgtc |
99 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| ||||||||||| | ||||||||||||| |
|
|
| T |
22461558 |
cttgcttctgatgaggtgcttctgatgacgtcagcttctgatgtactccagaaccacttgtc |
22461497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 22673992 - 22674040
Alignment:
| Q |
23 |
tcagcttctggtaaacttgcttgtgatg-acatgcttctgatgacgtca |
70 |
Q |
| |
|
|||||||||| ||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
22673992 |
tcagcttctgataaacttgcttctgatgaacttgcttctgatgacgtca |
22674040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 112 - 170
Target Start/End: Complemental strand, 11144398 - 11144340
Alignment:
| Q |
112 |
attacaatttaattttggatattcaaaaaatcatccaaataaaaccatatttaattgga |
170 |
Q |
| |
|
||||||||| ||||| ||||||||||| | |||||||||||||| |||||||||||| |
|
|
| T |
11144398 |
attacaattgtattttaaatattcaaaaactgatccaaataaaaccgtatttaattgga |
11144340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 70
Target Start/End: Complemental strand, 29138327 - 29138279
Alignment:
| Q |
23 |
tcagcttctggtaaacttgcttgtgatg-acatgcttctgatgacgtca |
70 |
Q |
| |
|
|||||||||| ||||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
29138327 |
tcagcttctgataaacttgcttctgatgaacttgcttctgatgacgtca |
29138279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 69
Target Start/End: Original strand, 5213781 - 5213826
Alignment:
| Q |
24 |
cagcttctggtaaacttgcttgtgatgacatgcttctgatgacgtc |
69 |
Q |
| |
|
||||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
5213781 |
cagcttctgataaacttgcttatgatgaactgcttctgatgacgtc |
5213826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University