View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12241_low_24 (Length: 256)
Name: NF12241_low_24
Description: NF12241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12241_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 243747 - 243982
Alignment:
| Q |
7 |
gagagatgaagttgatatgcttgagattgctggcttgattagccctcacttccttaattgaaggcaaggtttagtttttatatcaaggccacattttggt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
243747 |
gagagatgaagttgatatgcttgagattgctggcttgattagccctcacttccttaattgaaggcaaggtttagtttttatatcaaggccacattttggt |
243846 |
T |
|
| Q |
107 |
gtatggaactgttatatttggaagtatgtgtcctgcaactgcaacatagtagtagccttagnnnnnnnnnnnngttagtactttgggtacagaacaagat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
243847 |
gtatggaactgttatatttggaagtatgtgtcctgcaactgcaacatagtagtagccttagttttttgtttttgttagtactttgggtacagaacaagat |
243946 |
T |
|
| Q |
207 |
tctgttgaagatttcgttttgaatcatgtaatttct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
243947 |
tctgttgaagatttcgttttgaatcatgtaatttct |
243982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 75 - 130
Target Start/End: Complemental strand, 21206182 - 21206127
Alignment:
| Q |
75 |
gtttagtttttatatcaaggccacattttggtgtatggaactgttatatttggaag |
130 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21206182 |
gtttagtttttatatgaaggccacattttggtgtatggaactattatatttggaag |
21206127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 189 - 242
Target Start/End: Complemental strand, 21206086 - 21206033
Alignment:
| Q |
189 |
ttgggtacagaacaagattctgttgaagatttcgttttgaatcatgtaatttct |
242 |
Q |
| |
|
||||||||||||||||| | |||||||||| ||||||||| ||||||||||| |
|
|
| T |
21206086 |
ttgggtacagaacaagactaaattgaagattttgttttgaatgatgtaatttct |
21206033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University