View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12241_low_30 (Length: 229)
Name: NF12241_low_30
Description: NF12241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12241_low_30 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 47436657 - 47436885
Alignment:
| Q |
1 |
acgatctaatacattagtcattgaatgaattaaaaaataaacttttgtttataactgagaccagaggaaatacacatttatttttaagggttcaccatgc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47436657 |
acgacctaatacattagtcattgaatgaattaaaaaataaacttttgtttataaccgagaccagaggaaatacacatttatttttaagggttcaccgtgc |
47436756 |
T |
 |
| Q |
101 |
atgtaagatctcacatttcaatagggttttcataatcctttaccttaatttggttgcgcttgttttgaaaccagaacttgatttgcgtcggtgtaagacc |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| || |
|
|
| T |
47436757 |
atgtaagatctcaaatttcaatagggttttcataatcctttaccttaatttggttgcgcttgttttgaaactagaacttgatttgcgcaggtgtaaggcc |
47436856 |
T |
 |
| Q |
201 |
tagctcacaactcaattgtttcctttgct |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47436857 |
tagctcacaactcaattgtttcctttgct |
47436885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 47
Target Start/End: Complemental strand, 11864722 - 11864682
Alignment:
| Q |
8 |
aatacattagtcattgaatgaatt-aaaaaataaacttttg |
47 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
11864722 |
aatacattaatcattgaatgaattcaaaaaataaacttttg |
11864682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 54
Target Start/End: Complemental strand, 52532748 - 52532696
Alignment:
| Q |
3 |
gatctaatacattagtcattgaatgaat-taaaaaataaacttttgtttataa |
54 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
52532748 |
gatcaaatacattagttattgaatgaatataaaaaatgaacttttgtttataa |
52532696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University