View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12241_low_32 (Length: 217)
Name: NF12241_low_32
Description: NF12241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12241_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 18100137 - 18100340
Alignment:
| Q |
1 |
tagttaatgaagaactgtggaaagaagcacaaacgtatggagacatacagttgatgccgtttgttgactactacagcctcatcacctggaaatctttagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18100137 |
tagttaatgaagaactgtggaaagaagcacaaacgtatggagacatacagttgatgccgtttgttgactactacagcctcatcacctggaaatctttagc |
18100236 |
T |
 |
| Q |
101 |
aatatgtattttcggggtaatgtccgttgtcttgtattttctttgacttggcaggaaaatctttcctcttctcattggcaatatcttttgaacagacaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18100237 |
aatatgtattttcggggtaatgtccgttgtcttgtattttctttgacttggcaggaaaatctttcctcttctcattggcaatatcttttgaacagacaca |
18100336 |
T |
 |
| Q |
201 |
ggtt |
204 |
Q |
| |
|
|||| |
|
|
| T |
18100337 |
ggtt |
18100340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University