View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12242_low_10 (Length: 241)
Name: NF12242_low_10
Description: NF12242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12242_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 26455814 - 26456048
Alignment:
| Q |
1 |
ccgactttgtcatcatggtgttcctagctgaagcatccaccaactttcttattagggctctcaacctttgaggggagatt-----------gagctcatc |
89 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26455814 |
ccgactttgtcatcatggtgttcccagctgaagcatccaccaactttcttattagggctctcaacctttgaggggagattttcatttggttgagctcatc |
26455913 |
T |
 |
| Q |
90 |
tatatcgtggccaggacaccatttcagtaacaatnnnnnnnntgctctcatgtgtcatgcaaagactctgcatcagcatgcttaaaatgagtgattttag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26455914 |
tatatcgtggccaggacaccatttcagtaacaataaaaaaaatgctctcatgtgtcatgcaaagactctgcatcagcatgcttaaaatgagtgattttag |
26456013 |
T |
 |
| Q |
190 |
cacgattttatccatgaacttggtgactgcaaaca |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26456014 |
cacgattttatccatgaacttggtgactgcaaaca |
26456048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 134 - 222
Target Start/End: Original strand, 26456315 - 26456401
Alignment:
| Q |
134 |
ctctcatgtgtcatgcaaagactctgcatcagcatgcttaaaatgagtgattttagcacgattttatccatgaacttggtgactgcaaa |
222 |
Q |
| |
|
||||||||||||||||||||| | ||||||| |||||| ||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26456315 |
ctctcatgtgtcatgcaaagaatatgcatcaacatgctcaaaatgagtgactttagcacgattt--cccatgaacttggtgactgcaaa |
26456401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 3 - 80
Target Start/End: Original strand, 26456171 - 26456248
Alignment:
| Q |
3 |
gactttgtcatcatggtgttcctagctgaagcatccaccaactttcttattagggctctcaacctttgaggggagatt |
80 |
Q |
| |
|
|||||||| |||||||||||| | || ||||||||| |||| |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
26456171 |
gactttgttttcatggtgttcccaacttaagcatccaacaacattcttatttgggctctcaacctttgagtggagatt |
26456248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University