View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12242_low_6 (Length: 363)
Name: NF12242_low_6
Description: NF12242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12242_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 8e-77; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 67 - 245
Target Start/End: Complemental strand, 21787786 - 21787608
Alignment:
| Q |
67 |
gatgtgactaactatatttagaccgggttcatatatgccatannnnnnnagaggtaattcttttcaggtagaaaaaattatagcaatgacttgaaataaa |
166 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21787786 |
gatgtgactaactatttttagaccgggttcatatatgccatatttttttagaggtaattcttttcaggtagaaaaaattatagcaatgacttgaaataaa |
21787687 |
T |
 |
| Q |
167 |
gtcttttgacattgatgatgattaattttgctcttttaattcatttatatgcacagcaactttgtttccactcctcatg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21787686 |
gtcttttgacattgatgatgattaattttgcacttttaattcattgatatgcacagcaactttgtttccactcctcatg |
21787608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 15 - 51
Target Start/End: Complemental strand, 21787818 - 21787782
Alignment:
| Q |
15 |
ctgtgggtcaggcatacggaataaaatgtgtggatgt |
51 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
21787818 |
ctgtgggtcaggcttacggaaaaaaatgtgtggatgt |
21787782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 221 - 300
Target Start/End: Complemental strand, 21794412 - 21794332
Alignment:
| Q |
221 |
agcaactttgtttccactcctcatgtcaatta-ggtttttcaaatagtcaacagaattctctggattggaatgcttgtttc |
300 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||| ||| ||| ||||||||||| ||||| ||||| ||||||| |
|
|
| T |
21794412 |
agcaacgttgtttcaactcctcatgtcaattagggtttcgcaagaagttaacagaattctttggataggaattattgtttc |
21794332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University