View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12243_high_5 (Length: 221)
Name: NF12243_high_5
Description: NF12243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12243_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 41277925 - 41277738
Alignment:
| Q |
15 |
gctctttaagtttgaggtaagtgattatttatcattcttgctaatttatgctacaaacttagtgaaaatgtattatggtacctattttatcctatatgcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41277925 |
gctctttaagtttgaggtaagtgattatttatcattcttgctaatttatgctacaaacttagtgaaaatgtattatggtacctattttatcctatatgtc |
41277826 |
T |
|
| Q |
115 |
tatgaataaaataccttactgaggtcttgcttgctggtttgcagttgtattttgggcttttggtgtttgtgggttatgttgtagtaga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277825 |
tatgaataaaataccttactgaggtcttgcttgctggtttgcagttgtattttgggcttttggtgtttgtgggttatgttgtagtaga |
41277738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 152 - 202
Target Start/End: Original strand, 4214238 - 4214288
Alignment:
| Q |
152 |
tttgcagttgtattttgggcttttggtgtttgtgggttatgttgtagtaga |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4214238 |
tttgcagttgtattttgggcttttggtgtttgtgggttacattgtagtaga |
4214288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University