View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12244_low_2 (Length: 282)
Name: NF12244_low_2
Description: NF12244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12244_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 50 - 92
Target Start/End: Original strand, 10334762 - 10334803
Alignment:
| Q |
50 |
gactcttcttcatggcctttgaagaaatcccaaaatagccaat |
92 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10334762 |
gactcttcttcatggc-tttgaagaaatcccaaaatagccaat |
10334803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University