View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12244_low_3 (Length: 236)
Name: NF12244_low_3
Description: NF12244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12244_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10334689 - 10334468
Alignment:
| Q |
1 |
cttttagatgaggtgcctattttgggatgtgcggggcttggtcaatgccccgtcaagattggctctcaagagacttgtagatgagtataatcgcgataca |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10334689 |
cttttagatgaagtgcctattttgggatgtgcggggcttggtcaatgccccgtcaagattggctctcaagagacttgtagatgagtataatcgcgataca |
10334590 |
T |
 |
| Q |
101 |
tgcttaaatgcagaaacatggatgaatttttacagaatagcagaaacttatagaaattggttaagtagaatagctttcaaattgtttacctttgaataag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10334589 |
tgcttaaatgcagaaacatggatgaatttttatagaatagcagaaacttatagaaattggttgagtagaatagctttcaaattgtttacc-ttgaataag |
10334491 |
T |
 |
| Q |
201 |
agagtgaatttgctgccaaattt |
223 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
10334490 |
agagtgaatttgctgctaaattt |
10334468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University