View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12245_high_1_N (Length: 330)
Name: NF12245_high_1_N
Description: NF12245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12245_high_1_N |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 7494257 - 7493983
Alignment:
| Q |
1 |
agtgagtttgcagtaagccatgttttctcatttattgaggagtggtaaggcaaattgttgcagttcaatcttcttttgctcttaggcgttggaagtatca |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7494257 |
agtgagtttgtagtaagccatgttttctcatttattgtggagtggtaaggtaaattgttgcagttcaatcttcttttgctcttaggcgttggaagtatca |
7494158 |
T |
|
| Q |
101 |
tttggtcaataaggcttataggagctttggtggcatctatgttttttatgtccnnnnnnncttagagttgcgtggttaattagttggaagtaccaatcac |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7494157 |
tttggtcaataaggcttataagagctttggtggcatctatgttttttatgtcctttttttcttagagttgtgtggttaattagttggaagtaccaatcac |
7494058 |
T |
|
| Q |
201 |
gttttcaaccattactatcaataa----caaaacattg-----ataaatattatcaataattatttcaattatgc |
266 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7494057 |
attttcaaccattactatcaataaataacaaaacattgcaaaaataaatattatcaataattatttcaattatgc |
7493983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University