View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12245_low_1 (Length: 343)

Name: NF12245_low_1
Description: NF12245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12245_low_1
NF12245_low_1
[»] chr7 (1 HSPs)
chr7 (15-326)||(48926807-48927113)


Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 15 - 326
Target Start/End: Complemental strand, 48927113 - 48926807
Alignment:
15 ggagcagagaaaatttgaagggcatgtggttgctttggtgaagatgctgatgaagaagaacaagctgggaattgttgaggaagtgttggaagagttcatg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48927113 ggagcagagaaaatttgaagggcatgtggttgctttggtgaagatgctgatgaagaagaacaagctgggaattgttgaggaagtgttggaagagttcatg 48927014  T
115 aggatttatgatgaattatgtggaactcaagttgttttggtttcatcaaaaagagaaattggagaagatgaaatgtttgggattgccaaaagtgtgcaga 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48927013 aggatttatgatgaattatgtggaactcaagttgttttggtttcatcaaaaagagaaattggagaagatgaaatgtttgggattgccaaaagtgtgcaga 48926914  T
215 aactcagtggtgcagtgagggttaaggttaagaatttggttcaagaagagagttttccttcttcttttgcagcgtagtgtagtgtaaaatatagaattga 314  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||| |||||||||    
48926913 aactcagtggtgcagtgagggttaatgttaagaatttggttcaagaagagagttttccttcttcttttgc-----agtgtagtgtaaaatttagaattga 48926819  T
315 attatccattac 326  Q
    ||||||||||||    
48926818 attatccattac 48926807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University