View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12245_low_1 (Length: 343)
Name: NF12245_low_1
Description: NF12245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12245_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 15 - 326
Target Start/End: Complemental strand, 48927113 - 48926807
Alignment:
| Q |
15 |
ggagcagagaaaatttgaagggcatgtggttgctttggtgaagatgctgatgaagaagaacaagctgggaattgttgaggaagtgttggaagagttcatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48927113 |
ggagcagagaaaatttgaagggcatgtggttgctttggtgaagatgctgatgaagaagaacaagctgggaattgttgaggaagtgttggaagagttcatg |
48927014 |
T |
 |
| Q |
115 |
aggatttatgatgaattatgtggaactcaagttgttttggtttcatcaaaaagagaaattggagaagatgaaatgtttgggattgccaaaagtgtgcaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48927013 |
aggatttatgatgaattatgtggaactcaagttgttttggtttcatcaaaaagagaaattggagaagatgaaatgtttgggattgccaaaagtgtgcaga |
48926914 |
T |
 |
| Q |
215 |
aactcagtggtgcagtgagggttaaggttaagaatttggttcaagaagagagttttccttcttcttttgcagcgtagtgtagtgtaaaatatagaattga |
314 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
48926913 |
aactcagtggtgcagtgagggttaatgttaagaatttggttcaagaagagagttttccttcttcttttgc-----agtgtagtgtaaaatttagaattga |
48926819 |
T |
 |
| Q |
315 |
attatccattac |
326 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48926818 |
attatccattac |
48926807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University