View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12247_high_3 (Length: 261)
Name: NF12247_high_3
Description: NF12247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12247_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 28022620 - 28022855
Alignment:
| Q |
7 |
agaacctgtggtagaaatatcggtatcagaacttgtttttgatcttaaaagcaaaatcgaagacgagttggaggtgggagtacacaggcaaaatctctgg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022620 |
agaacctgtggtagaaatatcggtatcagaacttgtttttgatcttaaaagcaaaatcgaaaacgagttggaggtgggagtacacaggcaaaatctctgg |
28022719 |
T |
 |
| Q |
107 |
tacaagggtatagagttggataatgagaaaaggattggattctatgctttgtgcggagatgaaacagaaacagttactctcattgttgatccactgccat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28022720 |
tacaagggtatagagttggataatgagaaaaggattggattctatgctttgcgcggagatgaaacagaaacagttactctcattgttgatccgctgccat |
28022819 |
T |
 |
| Q |
207 |
cagacctgaaactacatgttttagtgaagtttcttg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022820 |
cagacctgaaactacatgttttagtgaagtttcttg |
28022855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University