View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12249_low_1 (Length: 359)
Name: NF12249_low_1
Description: NF12249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12249_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 196 - 347
Target Start/End: Original strand, 6885097 - 6885248
Alignment:
| Q |
196 |
ttatgtggcaaggaactttatacatacctattccttcacgaacagagagattaggcctcaaaatatcatttgggctaacgagaaaaatatctccaaggta |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6885097 |
ttatgtggcaaggaactttatacatacctattccttcacgaacagagagattaggcctcaaaatatcatttgggctaacgagaaaaatatctccaaggta |
6885196 |
T |
|
| Q |
296 |
caagtgattggtgggaatataaacacaataaagctcttcttcatctctgctc |
347 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6885197 |
caggtgattggtgggaatataaacacaataaagctcttcttcatctctgctc |
6885248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 18 - 138
Target Start/End: Original strand, 6884966 - 6885086
Alignment:
| Q |
18 |
ataacaatttctgtaacaacacatgagaacaaaaattattaaccaaaatcgaaaaactttggtgggaataacaatacaaaattattaaccagatataaca |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6884966 |
ataacaatttctgtatcaacacatgagaacaaaaattattaacgaaaatcgaaaaactttggtgggaataacaatacaaaattattaaccagatataaca |
6885065 |
T |
|
| Q |
118 |
attttaatacaaaagttttgt |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6885066 |
attttaatacaaaagttttgt |
6885086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University