View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12250_low_3 (Length: 282)
Name: NF12250_low_3
Description: NF12250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12250_low_3 |
 |  |
|
| [»] scaffold0717 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 17 - 269
Target Start/End: Original strand, 40011421 - 40011673
Alignment:
| Q |
17 |
agaaacaaatccaaaaacacaaccgcaaactcaatcgacaaaaccaactaaacccaccactctctaaatctcaaaaacaaacgttagaggaggaacaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011421 |
agaaacaaatccaaaaacacaaccgcaaactcaatcgacaaaaccaactaaacccaccactctctaaatctcaaaaacaaacgttagaggaggaacaaca |
40011520 |
T |
 |
| Q |
117 |
ctttcaggaactcaaacatgagtacaaacaatttacacaaaatttggaggaaaatgaaggagggaataaaggtttgtgtttgattgggaagccatgggaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011521 |
ctttcaggaactcaaacatgagtacaaacaatttacacaaaatttggaggaaaatcaaggagggaataaaggtttgtgtttgattgggaagccatgggaa |
40011620 |
T |
 |
| Q |
217 |
ggggttgaaaaagttgattttttggagagatttaaggtgaattatgagcacag |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40011621 |
ggggttgaaaaagttgattttttggagagaattaaggtgaattatgagcacag |
40011673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 2847603 - 2847746
Alignment:
| Q |
17 |
agaaacaaatccaaaaacacaaccgcaaactcaatcgacaaaaccaactaaacccaccactctctaaatctcaaaaacaaacgttagaggaggaacaaca |
116 |
Q |
| |
|
||||||||||| |||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
2847603 |
agaaacaaatctgaaaacacaaccgaaaaatcaatcgacaaaactaactaaacccaccactctctaaatcacaaaaacaaacgttaggggaggaacaaca |
2847702 |
T |
 |
| Q |
117 |
ctttcaggaactcaaacatgagtacaaacaatttacacaaaatt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2847703 |
ctttcaggaactcaaacatgagtacaaacaatttacacaaaatt |
2847746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0717 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: scaffold0717
Description:
Target: scaffold0717; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 6835 - 6978
Alignment:
| Q |
17 |
agaaacaaatccaaaaacacaaccgcaaactcaatcgacaaaaccaactaaacccaccactctctaaatctcaaaaacaaacgttagaggaggaacaaca |
116 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6835 |
agaaacaaatccaaaaacacaaccgaaaaatcaatcgacaaaaccaactaaacccaccactctctaaatctcaaaaacaaacgttagaggaggaacaaca |
6934 |
T |
 |
| Q |
117 |
ctttcaggaactcaaacatgagtacaaacaatttacacaaaatt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6935 |
ctttcaggaactcaaacatgagtacaaacaatttacacaaaatt |
6978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University