View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12250_low_4 (Length: 209)
Name: NF12250_low_4
Description: NF12250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12250_low_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 2 - 209
Target Start/End: Original strand, 48904058 - 48904272
Alignment:
| Q |
2 |
agacactcgagatatagttcttagcaagaagcccaaccatctcctttttcctaaagtcattcgatgctgttagcagaagcggttcctaattcattcgtgc |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48904058 |
agacactcaagatatagttcttagcaagaagcccaaccatctcctttttcctaa-gtcattcaatgctgttagcagaagcggttcctaattcattcgtgc |
48904156 |
T |
 |
| Q |
102 |
g---------aaaaaagatatcgtgcacttaagcattttccttaatcataacataagaaatgttttggatatcttaacttcagaaagagagaaatgaata |
192 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48904157 |
ggtttgtgcgaaaaaagatatcgtgcacttaagcattttccttaatcataacata-gaaatgttttggatatcttaacttcagaaagagagaaatgaata |
48904255 |
T |
 |
| Q |
193 |
gcttaaggaatcaaaca |
209 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
48904256 |
gcttaaggaatcaaaca |
48904272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University