View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12251_low_10 (Length: 340)
Name: NF12251_low_10
Description: NF12251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12251_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 19 - 328
Target Start/End: Original strand, 19396095 - 19396404
Alignment:
| Q |
19 |
ataacagcactaagccaattgttcaactcagcttcttttgaagctagtttgctaatatcaagttgcccgacttcagtgatcgagaatcccatttcttctt |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396095 |
ataacagcactaagccagttgttcaactcagcttcttttgaagctagtttgctaatatcaagttgcccgacttcagtgatcgagaatcccatttcttctt |
19396194 |
T |
|
| Q |
119 |
tagcatcctcaaacaactgtttacaatcttcataagctcccttttcttccttggaagcgaatttcaagttcgcggttttgttgaatgcgttgttaatttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396195 |
tagcatcctcaaacaactgtttacaatcttcataagctcccttttcttccttggaagcgaatttcaagttcgcggttttgttgaatgcgttgttaatttc |
19396294 |
T |
|
| Q |
219 |
attcttggcaactagcatgaaaaccattagaagaccctttggttctttcaatttagggtcttttttcaatgcctctttaagtgtggttacacatttttcc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19396295 |
attcttggcaactagcatgaaaaccattagaagaccctttggttctttcaatttagggtcttttttcaatgcctctttaagtgtggttacacatttttcc |
19396394 |
T |
|
| Q |
319 |
ttgtattctg |
328 |
Q |
| |
|
|||||||||| |
|
|
| T |
19396395 |
ttgtattctg |
19396404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University