View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12251_low_11 (Length: 305)
Name: NF12251_low_11
Description: NF12251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12251_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 36 - 292
Target Start/End: Complemental strand, 41107962 - 41107706
Alignment:
| Q |
36 |
aattgcaaacaggttaactaccctatcacgattgctattgtgtctgagattggttatttgaagctcatcggtgttttttacaggatctttttctctatgg |
135 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41107962 |
aattgcaaacaggttcactaccctatcacgattgctattgtgtctgagattggttatttgaagctcatcggtgttttttacaggatctttttctctatgg |
41107863 |
T |
 |
| Q |
136 |
ttatactaggacatcagcttctgtgatgaaaattacaaattttgttgtatggttaaactacctattatgagtatgattgatgatgacactgatgatagtc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41107862 |
ttatactaggacatcagcttctgtgatgaaaattacaaatattgttgtatggttaaactaactattatgagtatgattgatgatgacactgatgatagtt |
41107763 |
T |
 |
| Q |
236 |
tagaggatgtcactgacaggggatctgttttttctgaatgatatgttgactcattct |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41107762 |
tagaggatgtcactgacaggggatctgttttttctgaatgatatgttgactcattct |
41107706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 8 - 303
Target Start/End: Original strand, 35703551 - 35703858
Alignment:
| Q |
8 |
cttttatgtgacacagatcctgcttgagaattgcaaacaggttaactaccctatcacgattgctattgtgtctgagattggttatttgaagct------c |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||| || ||||||||| |||||||||||| | || ||| | |||||||||||| | |
|
|
| T |
35703551 |
cttttatgtgacaccagtcctgcttgagaattgcaaccaggttcacaaccctatcatgattgctattgtctttgtgatagattatttgaagctgattgtc |
35703650 |
T |
 |
| Q |
102 |
atcggtgttttttacaggatc-tttttctct-----atggttatactaggacatcagcttctgtgatgaaaattacaaattttgttgtatggttaaacta |
195 |
Q |
| |
|
|| |||||| || || ||||| ||||||| | |||| |||| ||||| | ||||||||| |||||||||||||||||||||| |||| ||||||| |
|
|
| T |
35703651 |
attggtgttcttaactggatcatttttcttttggttatggatatagtaggatagtagcttctgtaatgaaaattacaaattttgttgcatgggtaaacta |
35703750 |
T |
 |
| Q |
196 |
cctattatgagtatgattgatgatgacactgatgatagtctagaggatgtcactgacaggggatctgttttttctgaatgatatgttgactcattctgtg |
295 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| | ||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||| || |
|
|
| T |
35703751 |
cctattctgagtatgattgatgatgacactgctgataatttagaggatgtcactggcaggggatctcttttttctgaatcatatgttgactcattctatg |
35703850 |
T |
 |
| Q |
296 |
ctcctcct |
303 |
Q |
| |
|
|| ||||| |
|
|
| T |
35703851 |
ctgctcct |
35703858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 24 - 110
Target Start/End: Original strand, 35708524 - 35708610
Alignment:
| Q |
24 |
atcctgcttgagaattgcaaacaggttaactaccctatcacgattgctattgtgtctgagattggttatttgaagctcatcggtgtt |
110 |
Q |
| |
|
|||||||||||||||||||| |||||| || ||||||||| |||||||||||| |||||||| | ||||||||||||||| |||||| |
|
|
| T |
35708524 |
atcctgcttgagaattgcaaccaggttcacaaccctatcatgattgctattgtctctgagatcgattatttgaagctcattggtgtt |
35708610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University