View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12251_low_13 (Length: 263)
Name: NF12251_low_13
Description: NF12251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12251_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 155 - 243
Target Start/End: Complemental strand, 39288718 - 39288630
Alignment:
| Q |
155 |
tcactgttatgtatgaactactataacaacgacagatgcaacattgcgaacacaaaaccataaacatattataaacatgaatatggata |
243 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39288718 |
tcactgttatgtattaactgctataacaacgacagatgcaacattgcgaacacaaaaccataaacatattataaacataaatatggata |
39288630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 39288854 - 39288783
Alignment:
| Q |
17 |
gtgctccggaggcaccggttaacaagacccaaaacataatctactcaacataaaaaatgtcgattctaatac |
88 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39288854 |
gtgctccgaaggcaccagttaacaagacccaaaatataatatactcaacataaaaaatgtcgattctaatac |
39288783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University