View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12251_low_13 (Length: 263)

Name: NF12251_low_13
Description: NF12251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12251_low_13
NF12251_low_13
[»] chr5 (2 HSPs)
chr5 (155-243)||(39288630-39288718)
chr5 (17-88)||(39288783-39288854)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 155 - 243
Target Start/End: Complemental strand, 39288718 - 39288630
Alignment:
155 tcactgttatgtatgaactactataacaacgacagatgcaacattgcgaacacaaaaccataaacatattataaacatgaatatggata 243  Q
    |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
39288718 tcactgttatgtattaactgctataacaacgacagatgcaacattgcgaacacaaaaccataaacatattataaacataaatatggata 39288630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 39288854 - 39288783
Alignment:
17 gtgctccggaggcaccggttaacaagacccaaaacataatctactcaacataaaaaatgtcgattctaatac 88  Q
    |||||||| ||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||    
39288854 gtgctccgaaggcaccagttaacaagacccaaaatataatatactcaacataaaaaatgtcgattctaatac 39288783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University