View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12251_low_16 (Length: 214)
Name: NF12251_low_16
Description: NF12251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12251_low_16 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 11 - 214
Target Start/End: Original strand, 33223742 - 33223944
Alignment:
| Q |
11 |
cacagaacagttgaatgtgagtgatttctagaataatggattcatacaagactcattggaagtctcgagatcaattatatgatgcacaaatgcatataag |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33223742 |
cacaaaacagttgaatgtgagtgatttctagaataatggatt-atacaagactcattggaagactcaagatcaattatatgatgcacaaatgcatataag |
33223840 |
T |
|
| Q |
111 |
agagaaaagtagagcgttacgtgattaacaatggtgctaggaattgtgactctgtatgttctagtgctaggagcaacaccgtgggcacttagcgctctgg |
210 |
Q |
| |
|
||||||||||| ||||||| | |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||| |
|
|
| T |
33223841 |
agagaaaagtacagcgttaggcgattaaaaatgatgctaggaattgtgactctgtatgttctagtgctaggagcaacaccgtgggcgcttagtgttctgg |
33223940 |
T |
|
| Q |
211 |
cgct |
214 |
Q |
| |
|
|||| |
|
|
| T |
33223941 |
cgct |
33223944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University