View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12252_high_8 (Length: 326)
Name: NF12252_high_8
Description: NF12252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12252_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 12799028 - 12799269
Alignment:
| Q |
1 |
gggacacggtcagtacggtcaggcatcgccctcattcactagtttgaataaattaataaatattattgacgtgaaatgggagcaaacactaacgatattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12799028 |
gggacacggtcagtacggtcaggcatcgccctcattcacaagtttgaataaattaataaatattattgacgtgaaatgagagcaaacactaacgatattg |
12799127 |
T |
 |
| Q |
101 |
actgaggaagtacataca------------ttatcatgatagcagttacacttcagatagataggatcattcatatttcatcatgaagtactttaagtca |
188 |
Q |
| |
|
| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12799128 |
attgaggaagtacatacattacagtgcatgttatcatgatagcagttacacttcagatagataggatcattcatatttcatcatgaagtactttaagtca |
12799227 |
T |
 |
| Q |
189 |
acatgcatggtacttacttaggattatcaatttaaatgataa |
230 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
12799228 |
acatgcatggtccttacttaggattatcaatttaaataataa |
12799269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 272 - 326
Target Start/End: Original strand, 12799273 - 12799327
Alignment:
| Q |
272 |
tgacatcggtaataattttaatacgttaagaatgaatatatacgtcgatttcaac |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
12799273 |
tgacatcggtaataattttagcacgttaagaatgaatatatatgtcgatttcaac |
12799327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University