View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12252_low_12 (Length: 254)
Name: NF12252_low_12
Description: NF12252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12252_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 12 - 207
Target Start/End: Original strand, 8639774 - 8639969
Alignment:
| Q |
12 |
agcacagaggggtagaagaagtgcataaacatagtagccttgggctgtaggcacttgaatnnnnnnnnnnnnnntagttagtgatgagtgatgactaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8639774 |
agcacagaggggtagaagaagtgcataaacatagtagccttaggctgtaggcacttgaataaaaaaagggggggtagttagtgatgagtgatgactaaca |
8639873 |
T |
 |
| Q |
112 |
aacaaacaaaaatgaaaattcaaagcttttttccattgccaaatgcccaactccggattcctgagtacattgtgatactttatttgaaacgtaagt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8639874 |
aacaaacaaaaatgaaaattcaaagcttttttccattgccaaatgcccaactctggattcctgagtacattgtgatactttatttgaaacgtaagt |
8639969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University