View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12254_low_13 (Length: 205)
Name: NF12254_low_13
Description: NF12254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12254_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 7 - 187
Target Start/End: Original strand, 14732852 - 14733032
Alignment:
| Q |
7 |
gaggagcagagagaccagaattggaggaaatagcctaaggaatagtttttgttttgatgatataagaaagagtcatggcttaagaagacaaagtacacaa |
106 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14732852 |
gaggaacagaaagaccagaattggaggaaatagcctaaggaatggtttttgttttgatgatataagaaagagtcatggcttaagaagacaaagtacacaa |
14732951 |
T |
 |
| Q |
107 |
aaagttttggcccgtgaagtttgcatgtgatcattaagagctgttataatcagtgcccttgcacattatagacccactcac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14732952 |
aaagttttggcccgtgaagtttgcatgtgatcattaagagctgttataatcagtgcccttgcacattatagacccactcac |
14733032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University