View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12255_low_9 (Length: 221)
Name: NF12255_low_9
Description: NF12255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12255_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 20 - 163
Target Start/End: Original strand, 3808778 - 3808921
Alignment:
| Q |
20 |
agtttctatatatttatttatgcagcttgtaattatgnnnnnnngttaacaaagattttgagcaacactcgaagggtcatcctcttggacatcaattatg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
3808778 |
agtttctatatatttatttatgcagcttgtaattatgtttttttgttaacaaagattttgagcaacactcaaagggtcatccgcttggacatcaattatg |
3808877 |
T |
 |
| Q |
120 |
cgataagcttaacataacttgccatttactcatgtagaggtcga |
163 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
3808878 |
cgataagcttaacggaacttgccatttactcatgcagaggtcga |
3808921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University