View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12257_low_3 (Length: 240)
Name: NF12257_low_3
Description: NF12257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12257_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 39371934 - 39372144
Alignment:
| Q |
19 |
aaatgagatttaaggaggtttcgaatatgatcatcggaaactatcatttttcatcccctctaacaatttactaagaaatacttcttnnnnnnnnnnncaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39371934 |
aaatgagatttaaggaggtttcgaatatgatccttggaaactatcattttccatcccctctaacaatttactaagaaatacttctt-aaaaaaaaaacaa |
39372032 |
T |
 |
| Q |
119 |
tttactaacaaataatttttgcctatnnnnnnnnnnnngagcattatgattacagtaactcttacgaaaaccaaattaactacgttggatactcctccca |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39372033 |
tttactaacaaataatttttgcctat-aaaaaaaaaaagagcattatgattacactaactcttacgaaaaccaaattaactacgttggatactcctccca |
39372131 |
T |
 |
| Q |
219 |
agatcacaggttc |
231 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
39372132 |
agatttcaggttc |
39372144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University