View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12258_low_9 (Length: 246)
Name: NF12258_low_9
Description: NF12258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12258_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 20209052 - 20208845
Alignment:
| Q |
18 |
tctaaaagttgttgtgcaagaactgctcatgatattgttccttcggttagctccaaatggttgaggaagaagaatccacgtgttggactgttcctgtgtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
20209052 |
tctaaaagttgttgtgcaagaactgctcatgatattgttccttcggttagctccaaatggttgaggaagaaaaatccacgtgttggactgttcttgtgtt |
20208953 |
T |
 |
| Q |
118 |
ctttcagagttagagcttgtcaatccactgctaacaacaataataaggatatctacaaacaagtgggtctgttccaaaatgctgtcnnnnnnngtgtaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
20208952 |
ctttcagagttagagcttgtcaatccactgctaacaacaacaataaggatatctacaaacaagtgggtctgttccaaactgctgtctttttttgtgtaag |
20208853 |
T |
 |
| Q |
218 |
agcatgta |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
20208852 |
agcatgta |
20208845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University