View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12259_high_11 (Length: 244)
Name: NF12259_high_11
Description: NF12259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12259_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 3 - 226
Target Start/End: Complemental strand, 31710397 - 31710165
Alignment:
| Q |
3 |
acgaagagccaccttaattttgcaaaataccgtggccattttctcgaatcatatatatgattttaacataattcaaatgcaattatgaattactcgtaca |
102 |
Q |
| |
|
||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
31710397 |
acgaaaagccaccttaattttgtaaattaccgtggccattttctcgaatcatatatatgattttagcataattcaaatgcaattatgaattactagtaca |
31710298 |
T |
 |
| Q |
103 |
ttatcaaaactagcctagaataattttgcttgtcctttgtttttgttcataataattgagccaataatagcc---------gtacgtgtatgcaacatta |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31710297 |
ttatcaaaactagcctagaataattttgcttgtcctttgtttttcttcataataattgagccaataatagcctagaataatgtacgtgtatgcaacatta |
31710198 |
T |
 |
| Q |
194 |
tactgctagatcctcttttattttttgtatgat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31710197 |
tactgctagatcctcttttattttttgtatgat |
31710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University