View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12259_high_14 (Length: 225)
Name: NF12259_high_14
Description: NF12259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12259_high_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 31710602 - 31710377
Alignment:
| Q |
1 |
acatttttagcacttatgtttggctttggg-cattaatgaaattgtggcaaaagtagtataggatacgcgattgaagatttaaacgtcaaaccaaacata |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||| || ||||||||||||||||||| |||||||||||||| |
|
|
| T |
31710602 |
acatttttagcacttatgcttggctttggggctttaatgaaattgcggcaaaagtagtatagaatgcgcgattgaagatttaaacttcaaaccaaacata |
31710503 |
T |
 |
| Q |
100 |
tgttaagagtattattggtttgagaatttgtttttatctagttctcactaatcatttcggcctggtatatatcatgtctgatatctcagtagatttgtca |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31710502 |
tgttaagaatattattggtttgagaatttgtttttatctagttctcaccagtcatttcggcctcgtatatatcatgtctggtatctcagtagatttgtca |
31710403 |
T |
 |
| Q |
200 |
aaattacgaagagccaccttaatttt |
225 |
Q |
| |
|
|||| ||||| ||||||||||||||| |
|
|
| T |
31710402 |
aaatcacgaaaagccaccttaatttt |
31710377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University